Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 1738-2432(Print)
ISSN : 2288-0151(Online)
Reproductive & developmental Biology Vol.41 No.1 pp.7-16
DOI : https://doi.org/10.12749/RDB.2017.41.1.7

Knock-in Efficiency Depending on Homologous Arm Structure of the Knock-in Vector in the Bovine Fibroblasts

Se Eun Kim1, Da Som Park1, Deog-Bon Koo2, Man-Jong Kang1
1Department of Aniaml Science, College of Agriculture and Life Science, Chonnam National University, Gwangju 61186, Republic of Korea
2Department of Biotechnology, College of Engineering, Daegu University, Gyeongsan 38453, Republic of Korea
Corresponding author : +82-62-530-2113, mjkang@jnu.ac.kr
February 10, 2017 February 24, 2017 February 24, 2017

Abstract

The knock-in efficiency in the fibroblast is very important to produce transgenic domestic animal using nuclear transfer. In this research, we constructed three kinds of different knock-in vectors to study the efficiency of knock-in depending on structure of knock-in vector with different size of homologous arm on the β-casein gene locus in the somatic cells; DT-A_cEndo Knock-in vector, DT-A_tEndo Knock-in vector I, and DT-A_tEndo Knock-in vector II. The knock-in vector consists of 4.8 kb or 1.06 kb of 5’ arm region and 1.8 kb or 0.64 kb of 3’ arm region, and neomycin resistance gene(neor) as a positive selection marker gene. The cEndo Knock-in vector had 4.8 kb and 1.8 kb homologous arm. The tEndo Knock-in vector I had 1.06 kb and 0.64 kb homologous arm and tEndo Knock-in vector II had 1.06 kb and 1.8 kb homologous arm. To express endostatin gene as transgene, the F2A sequence was fused to the 5’ terminal of endostatin gene and inserted into exon 7 of the β-casein gene. The knock-in vector and TALEN were introduced into the bovine fibroblast by electroporation. The knock-in efficiencies of cEndo, tEndo I, and tEndo II vector were 4.6%, 2.2% and 4.8%, respectively. These results indicated that size of 3’ arm in the knock-in vector is important for TALEN-mediated homologous recombination in the fibroblast. In conclusion, our knock-in system may help to create transgenic dairy cattle expressing human endostatin protein via the endogenous expression system of the bovine β-casein gene in the mammary gland.


체세포에 있어서 Knock-in 벡터 상동영역 구조에 따른 Knock-in 효율

김 세은1, 박 다솜1, 구 덕본2, 강 만종1
1전남대학교 농업생명과학대학 동물자원학부
2대구대학교 공과대학 생명공학과

초록


    서 론

    유전자 적중방법은 상동재조합을 이용하여 지놈 상의 특정 위치에 외래유전자를 삽입하는 knock-in 방법과 특 정 유전자를 제거하는 knock-out 방법이 있다(Yáñez과 Porter, 1998; Müller, 1999; Clark 등, 2000). 유전자 적중 방법은 targeting 벡터를 embryonic stem cell에 도입하여 상동재조합에 의해 특정유전자의 변이를 가져오는 실험 을 통해 마우스에서 처음으로 시도되었다(Thomas과 Capecchi 1987). 가축에서도 양 태아의 섬유아세포를 이용 하여 양의 α1 precollagen 유전자 위치에서 β-lactoglobulin- α-anti-trypsin이 발현되는 체세포를 개발한 후 핵치환 방법에 의해 형질전환 양의 생산이 보고되었다(McCreath 등, 2000). 그 후 핵치환방법으로 형질전환 복제동물 을 생산하는 연구가 활발히 진행되고 있고, 이러한 형질 전환동물을 이용한 바이오 신약산업의 발전 가능성이 대 두되고 있다(Clark 등, 2000; Yang과 Carter, 2007).

    가축에 있어서 유전자 적중을 이용하여 McCreath 등 (2000)이 α1(I) procollagen (COL1A1) 위치에 양의 β-lac- toglobine 프로모터를 사용하여 유선으로부터 인간 α1-antitypsin이 발현되는 복제 양을 처음 생산하였다. 또한 Denning 등(2001)은 양에 있어서 이종간 장기이식시 급 성거부반응을 일으키는 α (1,3)-galatocyltransferase(GGTA- 1) 유전자를 knock-out 시킨 복제 양을 생산했다고 보고 하고 있다. 그러나 targeting 효율은 1.1%로 매우 낮은 효 율을 보고하였다. 그리고 장기이식용 복제 돼지로 이용하 기 위하여 α (1,3)-galatocyltransferase(GGTA1) 유전자가 knock- out된 복제 돼지가 유전자 적중방법에 의해서 생산되 었다(Lai 등, 2002). 그러나 일반적으로 GGTA1 유전자 위 치에 대한 유전자 적중 효율은 0%에서 9.3%로 보고되었 으며, 이러한 결과는 벡터에 사용된 상동영역의 크기에 의한 것으로 보고되었다(Klymiuk 등, 2010). 또한 양의 COL1A1, PrPGGTA1 유전자 위치에 대한 유전자 적중 효율은 1 66%로 보고되고 있으며, 이러한 효율의 차이 는 유전자의 위치와 벡터의 구조 등에 따라 그 차이를 나 태 내는 것으로 생각되어지고 있다(Denning과 Priddle, 2003).

    최근에는 Zinc Finger Nuclease (ZFN), Transcription activator-like effector nuclease (TALEN), Clustered regularly interspaed short palindromic repeats/Cas9 (CRISPR/ Cas9) 등의 유전자 가위를 이용하여 보다 더 나은 효율의 형질전환동물을 생산하고 있다(Gaj 등, 2013). 인 공핵산분해 효소 중 ZFN을 이용하여 Liu 등은 lysostaphin이 소 β-casein 유전자 위치에 knock-in된 소를 생산 하였다(Liu 등, 2013). 또한 사람 lysozyme 유전자가 소 β- casein 유전자 위치에 knock-in된 소가 생산되었으며, 이 러한 형질전환 소는 유방염에 저항성을 가지는 것으로 보고되었다(Liu 등, 2014). 이들은 체세포에 있어서 knock- in 효율은 ZFN를 이용하였을 경우 12.8 18.5%였으며, ZFN를 이용하지 않았을 경우는 0%의 효율을 보고하였다 (Liu 등, 2014). 이와 같이 체세포에 knock-in을 실시할 경우, 유전자 위치에 따라 그 효율이 다양한 것으로 보고 되고 있으며, TALEN을 이용하여 젖소 β-casein 유전자 위치에 knock-in 벡터 구조에 따른 효율은 보고된 바가 없다.

    따라서 본 연구에서는 젖소 β-casein 유전자의 exon 7 위치를 특이적으로 절단할 수 있는 TALEN을 사용하여 knock-in 벡터의 5‘ 및 3’ 상동영역의 길이에 따라 젖소 체세포에서 knock-in 효율을 확인하였다.

    재료 및 방법

    유전자 동정

    Knock-in 벡터 구축을 위한 4.95 kb의 5’ arm은 genome DNA를 주형으로 사용하고, NotI S primer(GCGGCCGCGAATTGAGAGCCATGAAGGTC) 와 SalI AS primer( GTCGACAATAATAGGGAAGGGTCCCCGGAC) 쌍 을 이용하여 PCR 증폭하였다. 1.06 kb의 5’ arm을 동정 하기에 앞서 먼저 TALEN 결합 부위가 β-casein 유전자 의 exon 7 위치에 존재하므로 아미노산 번역에는 변화가 없도록 TALEN 결합 부위에 변이를 도입하였다. 먼저 오 른쪽 TALEN 결합 부위에 변이를 도입하기 위하여 아래 와 같이 PCR point mutation을 실시하였다. 변이된 1,060 bp의 5’ 단편을 확보하기 위하여 기존에 확보되어 있는 T-easy_β-casein exon 2-exon 8 플라스미드를 주형으로 이용하고, NotI 제한효소 site가 포함된 sense primer (GCGGCCGCGGCACTTAGGCCAAATTCTAAATC) 와 AS1 primer(GACTGACAATGATAGGAAAGGGTC)을 이용하 여 PCR 증폭하였다. 변이된 238 bp의 3’ 단편을 확보 하기 위해서는 S1(GACCCTTTCCTATCATTGTCAGTC)와 AS2(TCAGAATCTCCACGGGTAAGCCTA) primer 쌍을 이용하여 PCR을 수행하였다. 변이된 1.3 kb의 5’ arm을 확보하기 위하여 위에서 확보한 1,060 bp의 단편 238 bp 의 단편을 1:1로 혼합한 후 이 혼합된 DNA 용액을 주형 으로 이용하여 아래와 같이 PCR을 수행하였다. PCR은 NotI 제한효소 site가 포함된 sense(GCGGCCGCGGCACTTAGGCCAAATTCTAAATC) 와 AS2 primer(TCAGAATCTCCACGGGTAAGCCTA) 을 사용하여 실시하였다. 왼쪽 TALEN 결합 부위의 point mutation을 도입하기 위하여 다음과 같이 PCR을 수행하였다. 변이된 1,030 bp의 5’ 단 편을 확보하기 위하여 앞에서 확보한 오른쪽 TALEN 결 합 부위에 변이가 도입된 pGEM T-easy_β-casein R2-RR 플라스미드를 주형으로 사용하고, NotI 제한효소 site가 포 함된 sense(GCGGCCGCGGCACTTAGGCCAAATTCTAAATC) 와 AS1 primer(GACTGACAATGATAGGAAAGGGTC) 를 이용하여 PCR을 수행하였다. 또한 273 bp의 3’ 단편을 확보하기 위하여 앞에서 확보한 오른쪽 TALEN 결합 부위에 변이가 도입된 pGEM T-easy_β casein R2-RR 플라스미드를 주형으로 사용하고, S2(CCTAGTACAGGCTCTTGGTAGAGC) 와 AS2 primer (TCAGAATCTCCACGGGTAAGCCTA) 을 이용하여 PCR을 수행하였다. 최종적으로 왼쪽 TALEN 결합 부위에 point mutation이 도입된 단편을 확보하기 위하여 위에서 확보한 약 1,030 bp의 단편과 273 bp의 단편을 1:1로 혼합하고, 이것을 주 형으로 이용하여 다음과 같이 PCR을 실시하였다. PCR은 NotI 제한효소 site가 포함된 sense(GCGGCCGCGGCACTTAGGCCAAATTCTAAATC) 와 AS2 primer(TCAGAATCTCCACGGGTAAGCCTA) 을 사용하여 실시하였다. Knock- in 벡터 제작에 사용할 1.06 kb의 5’ arm을 확보하기 위하여 양쪽 TALEN 결합 부위에 변이가 도입된 pGEM T-easy_β-casein L2-DAS 플라스미드를 주형으로 아래와 같이 PCR을 수행하였다. PCR은 NotI S primer (GCGGCCGCGGCACTTAGGCCAAATTCTAAATC) 와 XhoI AS primer(CTCGAGACAATGATAGGAAAGGGTCCCCG) 을 이용하여 실시하였다. Knock-in 벡터 구축을 위한 β -casein exon 8-exon 9을 포함하는 3’ arm(1.8 kb)은 기존 에 확보되어 있는 T-easy_βCE3 플라스미드를 주형으로 사용하고, SalI S primer(GTCGACCTAAATTTACTAACTGTGCTGTTTAACTTCTGAT) 와 XhoI AS primer(CTCGAGTATTCAATTTTAATTTTCCACAGCTCT) 쌍을 이용 하여 PCR 증폭하였다.

    β-casein exon 8-exon 9 mutant 3’ arm II(1.8 kb)는 3’ arm의 5’ 말단에 HindIII 제한효소의 사용을 위하여 먼저 3’ arm 640 bp 위치에 있는 HindIII 제한효소 위치에 po int mutation을 삽입하여 제한효소 부위가 작동하지 못하 도록 변이를 도입한 후 PCR로 동정하였다. PCR은 Hind- III S primer(AAGCTTCTAACTGTGCTGTTTAACTTCTGATGTT) 와 SalI AS primer(GTCGACTATTCAATTTTAATTTTCCACAGC) primer 쌍을 이용하여 변이가 도입된 전체 3’ arm을 동정하였다. β-casein exon 8 3’ arm I (0.64 kb)은 기존에 확보된 pGEM T-easy_β-casein exon 8-exon 9 3’ arm을 주형으로 사용하고, HindIII S primer (AAGCTTCTAACTGTGCTGTTTAACTTCTGATGTT)와 SalI AS primer(GTCGACAAAAGTGAGGAGGGGGCATTCACTT) 쌍을 이용하여 PCR 동정하였다. Endostain 유 전자는 knock-in 벡터 제작 시 제한효소 사용을 위해 3’ 말단의 제한효소를 다르게 2가지를 동정하였다. 먼저 기 존에 HepG2 세포로부터 RT-PCR에 의하여 확보되어 있 는 T-easy_endostain 플라스미드를 주형으로 사용하고, KpnI S primer(GGTACCCACAGCCACCGCGACTTCCAGCCGGTGCTC) 와 SalI AS primer(GTCGACCTACTTGGAGGCAGTCATGAAGCTGTTCTC) primer 쌍을 이용 하여 PCR을 실시하였다. 또한 KpnIXbaI 제한효소 site 를 가지는 단편을 확보하기 위하여 KpnI S primer와 XbaI AS primer(TCTAGACTACTTGGAGGCAGTCATGAAGCTGTTCTC) 쌍을 이용하여 PCR 증폭하였다. Knock- in 벡터 구축 시 사용된 Furin-2A(F2A), Bovine growth hormone PolyA(BGH polyA)와 PGK-neo 유전자는 이 전에 확보되어 있는 단편을 이용하였다(Jeong 등, 2015).

    Knock-in 벡터의 구축

    본 연구에서 DT-A_cEndo Knock-in 벡터는 상기 동정 된 유전자들을 이용하여 다음과 같은 순서에 의하여 제 조하였다. 먼저 전체 염기서열을 확인한 pGEM T-easy_ β-casein exon 2-exon 7 5’ arm 플라스미드로부터 NotISalI으로 절단하여 삽입체를 제작하고, pBSK(-)/NotISalI 벡터에 클로닝하였다. pBSK(-)_β-casein exon 2- exon 7 5’ arm 플라스미드를 SalI와 Kpnl으로 절단하여 벡터를 제작하고, pGEM T-easy_Furin-2A 플라스미드를 XhoI와 KpnI으로 절단하여 삽입체를 제작한 후 연결하였 다. 그리고 pGEM T-easy_endostatin(KpnI-SalI) 플라스미 드를 KpnISalI으로 잘라서 첫 번째 삽입체를 제작하고, pGEM T-easy_BGH polyA(XhoI-EcoRI) 플라스미드를 XhoI와 EcoRI으로 잘라서 두 번째 삽입체를 제작하였으 며, KpnIEcoRI으로 절단 제작한 pBSK(-)/KpnI-EcoRI 벡 터에 3 fragment ligation으로 클로닝하였다. pBSK(-)_β- casein 5’_F2A 플라스미드는 NotI와 KpnⅠ으로 잘라 첫 번째 삽입체를 제작하고, pBSK(-)_endostatin_BGH poly- A 플라스미드를 KpnIEcoRI으로 잘라서 두번째 삽입체 를 제작하였다. 그 후, NotIKpnI으로 잘라 제작한 pBSK(-)/NotI-KpnI 벡터에 3 fragment ligation으로 클로 닝하였다. pBSK(-)_PGK-neo 플라스미드를 SalI와 XhoI으 로 잘라서 벡터를 제작하고, pGEM T-easy_β-casein exon 8-exon 9 3’ arm 플라스미드를 SalI와 XhoI으로 잘라서 삽입체를 제작한 다음 벡터에 ligation시켰다. pBSK (-)_ β-casein 3'_PGK-neo 플라스미드를 NotIEcoRI으로 잘 라서 벡터를 제작한 후 pBSK(-)_β-casein 5’_F2A_endostatin _ BGH polyA 플라스미드를 NotIEcoRI으로 잘라 서 제작한 삽입체를 삽입하여 클로닝하였다. 최종적으로, pBSK(-)_β-casein 5'_F2A_endotatin_BGH polyA_PGKneo_ β-casein 3’ 플라스미드를 NotI와 XhoI으로 잘라서 삽입체를 제작한 후, NotI와 XhoI으로 잘라서 제작한 pMCDT-A/NotI-XhoI 벡터에 ligation시켜 knock-in 벡터 를 완성하였다.

    DT-A_tEndo Knock-in 벡터 I의 제작은 다음과 같이 실시하였다. 먼저 F2A(XhoI-KpnI)과 endostatin 유전자(KpnIXbaI) 을 pGEM T-easy_Furin-2A 플라스미드와 pGEM T-easy_endostain 플라스미드로부터 제한효소 절단에 의 하여 확보한 다음 pBKS(-)/XhoI-XbaI 벡터에 3 fragment ligation을 실시하여 pBKS(-)_F2A_endostatin 플라스미드 를 확보하였다. pGEM T-easy_β-casein exon 7 mutant 5’ arm 플라스미드를 NotI와 XhoI으로 절단하여 약 1.06 kb의 단편을 확보하고 pBKS(-)_F2A_endostatin 플라스미 드를 XhoI와 XbaI으로 절단한 F2A_endostatin 단편을 pBSK(-)m를 NotIXbaI으로 절단한 벡터에 각 단편을 3 fragment liagtion시켜 pBSK(-)m_β-casein m5’_F2A_endostatin 플라스미드를 확보하였다. BGH polyA 단편을 endostatin 뒤에 삽입하기 위하여 pBSK (-)m_β-casein m5’_F2A_endostatin 플라스미드를 BamHI와 EcoRI으로 절단하여 벡터를 제조한 후 pGEM T-easy_BGH polyA (BamHI-EcoRI) 플라스미드로부터 확보한 BGH polyA 단 편(BamHI-EcoRI)을 subcloning하여 pBSK(-)m_β-casein m5’_F2A_endostatin_BGH polyA 플라스미드를 확보하였 다. 마커 유전자인 PGK-neo 유전자를 삽입하기 위하여 기 존에 확보되어 있는 pBSK(-)/ pKJ2-neo(EcoRI-HindIII) 플 라스미드를 EcoRIHindIII로 절단하여 PGK-neo(EcoRIHindIII) 단편을 확보한 다음 pBSK(-)m_β-casein m5’_ F2A_endostatin_BGH polyA 플라스미드를 EcoRI와 Hind- III로 절단하여 제조한 벡터에 subcloning하여 pBSK(-)m_ β-casein m5’_F2A_endostatin_BGH polyA_PGK-neo 플 라스미드를 확보하였다. 3’ arm을 연결하기 위하여 pBSK (-)m_β-casein m5’_F2A_endostatin_BGH polyA_PGKneo 플라스미드를 HindIIISalI으로 절단하여 벡터를 구 축한 다음 pGEM T-easy_β-casein exon 8 3’ arm I 플라 스미드로부터 확보한 3’ arm 단편(HindIII-SalI)을 subcloning하여 pBSK(-)m_β-casein m5’_F2A_endostatin_ BGH polyA_PGK-neo_3’ I 플라스미드를 확보하였다. 최종 knock-in 벡터를 구축하기 위하여 pBSK(-)m_β-casein m5'_F2A_endostatin_BGH polyA_PGK-neo_3’ I 플라스미 드를 NotISalI으로 절단한 다음 확보된 단편을 NotISalI으로 잘라서 제작한 pMCDT-A/NotI-SalI 벡터에 ligation 하여 knock-in 벡터를 완성하였다.

    DT-A_tEndo Knock-in 벡터 II을 제작하기 위하여 pBSK (-)m_β-casein m5’_F2A_endostatin_BGH polyA_PGKneo_ 3’ I 플라스미드를 HindIIISalI으로 절단하여 벡터 를 제작한 다음 pGEM T-easy_β-casein exon 8-exon 9 3’ arm II 플라스미드로부터 확보한 3’ arm 단편(Hind- III-SalI)을 subcloning하여 pBSK(-)m_β-casein m5'_F2A_ endostatin_BGH polyA_PGK-neo_3’ II 플라스미드를 확 보하였다. 최종 knock-in 벡터를 제작하기 위하여 pBSK (-)m_β-casein m5'_F2A_endostatin_BGH polyA_ PGK neo_3’ II 플라스미드를 NotISalI으로 절단한 단편을 NotI와 SalI으로 잘라서 제작한 pMCDT-A/NotISalI 벡터 에 ligation하여 knock-in 벡터를 완성하였다.

    TALEN 제작과 활성 검증

    젖소 β-casein 유전자 exon 7위치를 절단할 수 있는 TALEN은 툴젠으로부터 합성하였으며, TALEN은 left binding site가 TGTACCAGGAGCCTGTACTC이며, right binding site는 TACAATAATAGGGAAGGGTC을 인식할 수 있도록 합성하였다. TALEN의 활성 검증은 다음과 같 이 실시하였다. MAC-T 세포를 6 mm dish에 2×105세포 로 seeding한 다음 1일 후에 각 left, right TALEN DNA 6ug을 이용하여 DharmaFECT regent(Thermo, Waltham, USA)로 transfection을 실시하였다. TALEN의 활성을 측 정하기 위하여 먼저 TALEN에 의하여 절단될 수 있는 부 위를 포함하는 단편을 TALEN S(GAGTCTCCAAAGTGAAGGAGGCTATGG) 와 TALEN AS(GGTTCTCAACAGACCAATTAAATCATAGT) primer 쌍을 이용하여 PCR 을 실시하였다. PCR은 Solg Pfu DNA polymerase (Solgent, Daejun, Korea)을 이용하여 94℃ 30초, 62℃ 40 초, 72℃ 1분의 33cycle의 조건에서 실시하였다. 증폭된 product는 pGEM T-easy 벡터(Promega Co., Wisconsin, USA)에 클로닝하여 염기서열을 결정하여 TALEN 절단 부위의 insertion과 deletion(indels) 현상을 확인하였다. T7 endonuclease I에 의한 활성 측정은 먼저 PCR product를 QIAgen quick Gel extract Kit(QIAgen, Venlo, Nederland) 로 처리한 후 450ng의 DNA을 이용하여 실시하 였다. 먼저 DNA 단편을 PCR 기계를 이용하여 95℃에서 10분 처리한 다음 85℃ 1분, 75℃ 1분, 65℃ 1분, 55℃ 1 분, 45℃ 1분, 35℃ 1분, 25℃ 1분 처리하였다. 이렇게 처 리된 DNA에 T7 endonuclease I(NEB, Ipswich, USA) 1 μL(2 또는 4 unit)을 넣고 37℃에서 15분 처리한 후 2% 아가로스 젤에서 전기영동하여 절단된 단편을 확인하였다.

    세포 배양 및 Knock-in 벡터의 도입

    젖소 섬유아세포에 knock-in 벡터의 도입은 전기천공 법(electroporation)을 이용하여 보고된 이전 방법을 다소 변경하여 실시하였다(Jeong 등, 2015). 90% 정도 confluence하게 배양한 젖소 섬유아세포를 EDTA-PBS로 1회 세척한 후 0.25% Trypsin-EDTA를 처리하였다. 세포를 배 양액으로 현탁한 다음 800 rpm에서 5분간 원심분리하여 세포를 회수하였고 다시 Ham’s F-10(Gibco-BRL, Waltham, USA) 배양액으로 현탁한 다음 원심분리 후 세척하 였으며 회수된 세포는 1.25×107세포/mL이 되도록 현탁한 다음 전기천공법에 이용하였다. Knock-in 벡터의 도입에 있어서는 NotI으로 절단하여 직선화된 knock-in 벡터 5 μg과 TALEN2 left 2.5 μg 및 TALEN2 right 2.5 μg을 100 μL Ham’s F-10(Gibco) 배지에 융해한 후 세포 현탁 액 400 μL(5×106 세포)와 혼합한 다음 4 mm gap 큐벳에 세포 및 벡터 혼합액을 넣었다. 상기 큐벳을 BTX Electrocell manipulator(BTX, Holliston, USA)에 장착한 다음 450 V, 4 pulses, 1 ms 조건에서 전기충격을 실시하였다. 전기충격 후 큐벳을 얼음 위에 10분 간 방치한 후 배양액 으로 현탁하고 24 well 플레이트의 각 well당 약 4,000 세 포가 들어가도록 분주하여 배양하였다. 벡터를 세포에 도 입한 다음 48시간 후 500 μg/mL의 G418(Gibco-BRL)로 10~12일간 선별하였다. 선별된 콜로니(colony)는 트립신 처리에 의하여 6 well로 계대 배양하였으며, 3 내지 4일 후 세포가 배양용기 바닥에서 포화상태가 되면 100 mm dish로 계대 배양하여 동결 보존하였다.

    Knock-in 세포의 PCR 동정

    Knock-in 세포의 PCR 동정을 위한 세포 추출물과 genome DNA 준비는 이전에 보고된 방법에 따라 실시하였 다(Jeong 등, 2015). 체세포의 넉-인 여부 확인은 세포 추 출물을 이용한 1차 PCR과 genome DNA을 이용한 2차 PCR을 실시하여 수행하였다. 2차 PCR에서는 3’ arm PCR, 5’ arm PCR과 targeted와 non-targeted PCR을 실 시하여 knock-in 여부를 확인하였다.

    DT-A_cEndo Knock-in 벡터가 도입된 체세포의 1차 PCR은 cEndo 3’ arm S primer(TGCTTGCCGAATATCATGGTGGAAAAT) 와 cEndo 3’ arm AS primer(ACCACACTGTAGAGCTGTGATTCAGATACC) 을 사용하고, 20 μL의 세포 현탁액을 이용하여 Ex Taq polymerase (Takara, Shiga, Japan)로 실시하였으며, PCR 조건은 94℃ 30 초, 58℃ 30초, 72℃ 3분에서 35 cycle을 수행하였다. PCR 산물의 확인은 0.8% 아가로스 젤에서 전기영동하여 약 2.2 kb의 밴드를 확인하였다. 2차 PCR에서 3’ arm PCR 은 genome DNA 100 ng을 이용하여 위의 1차 PCR과 동 일한 조건에서 실시하였다. 5’ arm PCR은 1차 PCR에서 positive로 확인된 세포로부터 제조한 genome DNA (10 ng)을 주형으로 이용하고, cEndo 5‘ arm S primer (GCTGTTAGCTGAAAACATCTGGATGGCTGG) 와 cEndo 5’ arm AS primer(TGCTAAAGCGCATGCTCCAGACTGCCTTGG) 를 사용하여 PCR을 수행하였다. PCR 조건은 98 ℃ 10초, 74℃ 3분에서 5 cycle, 98℃ 10초, 72℃ 3분에 서 5 cycle, 98℃ 10초, 70℃ 3분에서 5 cycle, 98℃ 10초, 68 ℃ 3분에서 20 cycle의 조건으로 PCR을 수행하였다. PCR 산물의 확인은 0.8% 아가로스 젤에서 전기영동하여 약 5.9 kb의 밴드를 확인하였다. Targeted된 allele과 nontargeted allele을 동시에 확인할 수 있는 targeted와 non-targeted PCR은 다음과 같이 실시하였다. PCR에는 100 ng의 genome DNA을 주형으로 이용하고, S Primer( GCTGTTAGCTGAAAACATCTGGATGGCTGG)와 AS primer(TGGTACACTGATGGAAATTGCTACTATTGG) 을 사용하였으며, PrimeSTAR HS DNA polymerase with GC buffer(Takara)로 PCR을 실시하였다. PCR 조건은 95 ℃ 10초, 58℃ 5초, 72℃ 5분 30초에서 33 cycle을 수행하 였다. PCR 산물의 확인은 0.8% 아가로스 젤에서 전기영 동하여 약 4.4 kb의 targeted allele과 2.2 kb의 non-targeted allele을 확인하였다.

    DT-A_tEndo Knock-in 벡터 I가 도입된 체세포의 세포 추출물을 이용한 1차 PCR은 S primer(CGATCAGGATGATCTGGACAAGAGCATCA) 와 AS primer(TTCTATCCCCCTTTTAAGTCCCATATCTGG) 을 이용하고, Ex Taq DNA polymerase(Takara)을 사용하여 실시하였다. PCR 조건은 94℃ 30초, 63℃ 30초, 72℃ 1분 30초에서 35 cycle를 수행하였다. PCR 산물의 확인은 0.8% 아가로스 젤 에서 전기영동하여 약 1.5 kb의 밴드를 확인하였다. 2차 PCR에 있어서 3’ arm PCR은 genome DNA 100 ng을 이 용하여 위의 1차 PCR과 동일한 조건에서 실시하였다. 5’ arm PCR은 1차 PCR에서 positive로 확인된 세포로부터 제조한 genome DNA(10 ng)을 주형으로 이용하고, S primer(GTAGGAACATTTCCAGACTAGGGACTG)와 AS primer(TGCTAAAGCGCATGCTCCAGACTGCCTTGG) 을 사용하여 LA Taq polymerase with GC buffer(Takara) 로 실시하였다. PCR 조건은 94℃ 30초, 58℃ 30초, 72℃ 2분 30초에서 33 cycle을 수행하였다. PCR 산물의 확 인은 0.8% 아가로스 젤에서 전기영동하여 약 2.4 kb의 밴 드를 확인하였다. Targeted된 allele과 non-targeted allele 을 동시에 확인할 수 있는 targeted와 non-targeted PCR 은 다음과 같이 실시하였다. 50 ng의 genome DNA을 주 형으로 이용하고 S primer(GTAGGAACATTTCCAGACTAGGGACTG) 와 AS primer(TGGTACACTGATGGAAATTGCTACTATTGG) 을 사용하고, PrimeSTAR HS DNA polymerase with GC buffer(Takara)로 실시하였다. PCR 은 95℃ 10초, 58℃ 5초, 72℃ 5분 30초에서 33 cycle을 수행하였다. PCR 산물의 확인은 0.8% 아가로스 젤에서 전기영동하여 약 4.4 kb의 targeted allele과 2.2 kb의 non-targeted allele을 확인하였다.

    DT-A_tEndo Knock-in 벡터 II가 도입된 체세포의 1차 PCR은 S primer(TGTGGCGGACCGCTATCAGGACATAGCGTT) 와 AS primer(ACCACACTGTAGAGCTGTGATTCAGATACC) 을 사용하고, Ex Taq DNA polymerase (Takara)로 실시하였다. PCR은 94℃ 30초, 56℃ 30초, 72 ℃ 3분에서 35 cycle을 수행하였다. PCR 산물의 확인은 0.8% 아가로스 젤에서 전기영동하여 약 2.2 kb의 PCR 산 물을 확인하였다. 2차 PCR에 있어서 5’ arm PCR은 10 ng의 genome DNA을 주형으로 이용하고, S primer (CAGCTGTATAACCTTGGCTCCATGTTTCTC) 와 AS primer (TGCTAAAGCGCATGCTCCAGACTGCCTTGG)을 이용 하고 FX Neo DNA polymerase(Toyobo)로 실시하였다. PCR 조건은 94℃ 30초, 68℃ 2분 2 step으로 33 cycle을 수행하였다. PCR 산물의 확인은 0.8% 아가로스 젤에서 전기영동하여 약 2.2 kb의 밴드를 확인하였다. Targeted 된 allele과 non-targeted allele을 동시에 확인할 수 있는 targeted와 non-targeted PCR은 DT-A_tEndo Knock-in 벡터 I가 도입된 체세포의 PCR 분석 방법과 동일한 방법 으로 수행하였다.

    결과 및 고찰

    Knock-in 벡터 구축과 염기배열 검증

    본 연구에서는 체세포에 있어서 knock-in 벡터의 활용 과 knock-in 벡터의 상동영역 크기에 따른 knock-in 효율 의 검증을 위하여 positive 선별마커가 PGK-neo인 knockin 벡터를 3가지 제작하였다.

    본 연구에서 구축된 knock-in 벡터는 β-casein exon 7 의 3’ 말단에 exon 8의 한 개 코돈이 연결되도록 하였으 며, 단백질 합성 시 β-caseinendostatin이 분리될 수 있 도록 F2A 염기서열을 그 뒤에 삽입하였다. Endostatin은 F2A 염기서열 뒤에 연결하였으며, BGH poly A signal에 의하여 발현될 수 있도록 구축되었다. 또한 positive 선별 마커로는 PGK-neo를 이용하였고, negative 선별마커로는 diphteria toxin A(DT-A) 유전자를 이용하였다. 이와 같 은 knock-in 벡터가 β-casein 위치에 상동 재조합되면 외 래유전자인 endostatin 유전자는 β-casein 유전자의 gene regulatory DNA sequence에 의하여 β-casein과 연결된 mRNA로 발현하게 된다. 이러한 mRNA를 이용하여 단 백질이 합성될 때는 β-casein은 정상적으로 합성이 되며, β-casein은 Furin cleavage site에 의하여 endostatin과 분 리될 수 있으며, 또한 2A peptiede의 self cleavage에 의 하여 분리될 수 있도록 고안되어 있다(Fig. 1).

    Knock-in 벡터의 상동영역 크기에 따른 knock-in 효율 의 검증을 위하여 DT-A_cEndo Knock-in 벡터는 Fig. 1A 에 제시한 바와 같이 β-casein exon 2에서 7을 포함하는 4.9 kb의 5’ arm을 이용하였으며, 3’ arm으로는 exon 8에 서 9를 포함하는 1.8 kb을 이용하여 제작되었다. DT-A_ tEndo Knock-in 벡터 I과 II는 Fig. 1B와 C에 나타낸 바 와 같이 구축하였다. DT-A_tEndo Knock-in 벡터 I은 β- casein exon 7을 포함하는 1.06 kb의 5’ arm으로 이용하 였으며, 3’ arm으로는 exon 8을 포함하는 0.64 kb을 이용 하였다. DT-A_tEndo Knock-in 벡터 II는 β-casein exon 7을 포함하는 1.06 kb의 5’ arm으로 이용하였으며, 3’ arm 으로는 exon 8과 9를 포함하는 1.8 kb을 이용하였다.

    Knock-in 벡터의 염기배열 결정으로 β-casein exon 7, F2A 염기서열, 그리고 endostatin 유전자의 염기서열을 연 결하였을 때의 nucleotide와 아미노산 서열을 Fig. 2에 제 시하였다. Endostatin 아미노산은 β-casein exon 7의 아미 노산과 F2A peptide와 in-frame으로 연결되어 있음을 확 인하였다. 또한 Mac-T 세포에 넉-인 벡터를 도입한 후 endostatin 유전자의 mRNA 발현을 RT-PCR로 확인되었 다(결과 제시 안함). 이러한 결과는 본 연구에서 개발한 knock-in 벡터가 상동유전자 재조합에 의하여 β-casein 위치에 삽입되면 정상적으로 endostatin 유전자가 발현될 수 있음을 나타낸다.

    2000년에는 McCreath 등(2000)이 처음으로 유전자 적 중방법을 이용하여 형질전환 양을 생산하였다고 보고하 고 있다. 이들은 양 태아의 섬유아세포를 이용하여 α1(I)procollagen 유전자 위치에 α1-antitrypsin 유전자를 삽입 하였으며, 650 μg/mL의 α1-antitrypsin이 포함된 우유를 생산하였다고 보고하고 있다. 2013년도에는 소 β-casein 위치에 lysostaphin 유전자를 ZFN를 이용하여 knock-in 한 형질전환 복제 소가 생산되었으며, 유즙으로부터 lysostaphin이 분비되었고 in vitro assay에 의하여 그 활성 이 검증되었다(Liu 등, 2013). 그리고 2014년도에는 소 β -casein 유전자 위치에 인간 lysozyme 유전자를 knock-in한 형질전환 복제 소가 생산되었으며, 이들 형질전환 소는 착유기간에 23∼31 μg/mL의 인간 lysozyme이 우유로부 터 분비된다고 보고하고 있다(Liu 등, 2014). 또한 Jeong 등(2015)은 사람 FGF2 유전자를 소 β-casein 엑손 3위치 에 F2A와 융합시켜 소 β-casein 유전자 위치에 knock-in 된 체세포를 확보하고 수정란을 생산하였다고 보고하고 있다. 이러한 결과는 본 연구에서 개발된 knock-in 벡터 에 의하여 형질전환 가축이 생산되면 유즙으로부터 endostatin이 분비될 수 있음을 나타낸다.

    TALEN 활성 검증

    TALEN은 툴젠으로부터 Fig. 3A에 제시한 binding site을 가지는 TALEN을 합성하였으며, 합성된 TALEN은 β-casein exon 7 영역 13 bp의 spacer 부분이 Fok1 nuclease에 의하여 절단될 수 있도록 고안되어 있다.

    TALEN의 활성을 검증하기 위하여 MAC-T 세포에 TALEN을 도입하고, 절단 부위를 포함하는 부분을 PCR 증 폭하여 T7 endonuclease I assay를 실시하였다. Fig. 3B에 제시한 바와 같이 TALEN을 도입하고 T7 endonuclease I assay를 실시한 결과, indel에 의하여 313 bp와 135 bp의 절단된 단편을 확인할 수 있었다. 이러한 결과는, 세포에 서 본 실험에서 사용한 TALEN이 내인성 target을 절단 하는 좋은 활성을 나타내고 있음을 제시한 것이다.

    TALEN은 ZFN를 대체할 수 있는 인공핵산 분해효소 이며, DNA의 double strand break을 유도할 수 있다고 알려져 있다(Joung과 Sander, 2013). 그리고 TALEN은 ZFN과 마찬가지로 DNA에 결합할 수 있는 부분과 Fok1 endonuclease가 연결된 형태로써 식물의 고병원균인 Xanthomonas 속 에서 발견된 TAL effector(TALEs)가 DNA에 결합할 수 있는 부분으로 알려져 있다(Miller 등, 2011). 2014년에는 소 serum albumin 유전자 위치에서 인간 serum albumin이 발현될 수 있는 knock-in 벡터를 TALEN 과 함께 소 섬유아세포에 삽입하였더니 수컷 세포에서는 9%, 암컷 세포에서는 13%의 knock-in 벡터 삽입 효율을 나타내었다고 보고되었다(Moghaddassi 등, 2014). 이러한 결과는 본 연구에서 활성을 나타내는 TALEN을 이용하 여 소 β-casein 엑손 7위치 knock-in 벡터를 knock-in 시 킬 수 있음을 나타낸다.

    Knock-in 벡터 구조에 따른 Knock-in 효율

    DT-A_cEndo Knock-in 벡터, DT-A_tEndo Knock-in 벡터 I와 DT-A_tEndo Knock-in 벡터 II를 젖소 귀로부터 제조한 체세포에 전기천공법으로 도입한 후, 상동유전자 재조합이 일어난 세포를 선별한 결과, 그 효율은 Table 1 에 제시한 바와 같다.

    DT-A_cEndo Knock-in 벡터를 transfection 하였을 경 우 G418 내성 colony는 127개가 선별되었으며, 이들 중 65개의 colony을 1차 PCR에 의하여 분석한 결과, 6개가 positive로 확인되었다. 이들 colony로부터 genome DNA 을 회수하여 3’ arm, 5’ arm과 targeted and non-targeted PCR을 수행한 결과, 최종적으로 3개의 positive colony가 검출되어 효율은 4.6%로 확인되었다. 1차 PCR 수행 후 확인된 colony의 genome DNA을 이용하여 2차 PCR을 수행하였을 때 Fig. 4에 제시한 바와 같이 3’ arm PCR을 수행한 결과, 47, 24, 26, 33 colony에서는 2.2 kb의 밴드가 확인되었다. 또한 5’ arm PCR에서는 24, 26, 33 colony에 서만 5.9 kb의 밴드가 확인되었으며, 상동유전자 재조합 이 일어난 allele와 그렇지 않은 allele을 확인하기 위하여 targeted와 non-targeted PCR을 수행한 결과, 24, 26, 33 colony에서 상동유전자 재조합이 일어난 4.4 kb와 상동유 전자 재조합이 일어나지 않은 2.2 kb의 밴드가 확인되었 다. 따라서 3개의 colony는 모두 한쪽 allele에서 상동유 전자 재조합이 일어난 heterozygous로 확인되었다.

    DT-A_tEndo Knock-in 벡터 I을 체세포에 도입하였을 경우에는 Table 1에서 제시한 바와 같이 2.2%의 상동유 전자 재조합 효율을 나타내고 있으며, DT-A_tEndo Knock- in 벡터 II을 도입한 처리군에서는 4.8%의 효율로 DTA_ tEndo Knock-in 벡터 I보다 좋은 효율을 나타내었다. DT-A_tEndo Knock-in 벡터 I이 도입된 knock-in 체세포 의 PCR 분석 결과는 Fig. 4에 제시한 바와 같이 3’ arm 1.5 kb 또는 0.9 kb, 5’ arm 2.4 kb 또는 2.2 kb가 검출되 었으며, targeted와 non-targeted allele을 증폭하기 위하 여 long PCR을 실시한 결과, 4.4 kb의 targeted band와 2.2 kb의 non-targeted band가 검출되었다. DT-A_tEndo Knock-in 벡터 II가 도입된 체세포의 PCR 분석 결과는 Fig. 4에 제시한 바와 같이 3’ arm 2.2 kb, 5’ arm 2.2 kb 가 검출되었으며, targeted와 non-targeted allele을 증폭 하기 위하여 long PCR을 실시한 결과, 4.4 kb의 targeted band와 2.2 kb의 non-targeted band가 검출되었다.

    이러한 결과는 고전적인 knock-in 벡터인 DT-A_cEndo Knock-in 벡터를 이용하거나, 5‘ arm이 약 1 kb로 짧은 벡터를 이용하더라도 knock-in이 가능하다는 것을 나타 내고 있으며, 3’ arm이 짧은 경우는 다소 효율이 낮다는 것을 나타내고 있다.

    Knock-in 벡터 제작 시 상동영역 길이에 따라 상동유 전자 재조합 효율이 다른 것으로 보고되고 있다(Klymiuk 등, 2010). 본 연구에서는 상동 영역 길이에 따라 체세포 에 있어서 knock-in 효율을 검증하기 위하여 5’ arm과 3’ arm의 길이가 다른 knock-in 벡터를 제작하였다. 그 결과, 5’ arm 4.9 kb와 3’ arm 1.8 kb를 가지고 있는 knock-in 벡터를 TALEN과 함께 체세포에 도입하였을 때 4.6%의 상동재조합 효율을 얻을 수 있었다. 그리고 1.06 kb의 5’ arm과 0.64 kb 또는 1.8 kb의 3’ arm을 사용하였을 때 3’ arm이 1.8 kb인 경우 4.8%로 0.64 kb의 3’ arm을 사용 할 때의 2.2% 효율 보다 높은 것으로 확인되었다. 체세포 에 있어서 유전자 가위인 ZFN, TALEN, CRISPR/Cas9을 이용하지 않는 고전적인 유전자 적중 실험에서는 유전자 적중 효율이 낮은 것으로 보고되고 있다. 일반적으로 유 전자 적중 벡터의 상동영역 크기에 따라 GGTA1 유전자 위치에 대한 유전자 적중 효율은 0%에서 9.3%로 보고되 었다(Klymiuk 등, 2010). 그리고 양의 COL1A1(McCreath 등, 2000), PrPGGTA1(Denning 등, 2001) 유전자 위치 에 대한 유전자 적중 효율은 1∼66%로 보고되었다(Denning 등, 2003). 최근에는 유전자 가위인 ZFN를 이용하 여 소 β-casein 위치에서 lysostaphin 유전자가 발현되는 knock-in 체세포를 확보하는데 있어서는 4.5∼19%의 유 전자 적중 효율을 보고하였다(Liu 등, 2013). ZFN를 이용 하여 소 β-casein 위치에서 인간 lysozyme이 발현하는 젖 소를 생산하는데 있어서, knock-in 체세포의 확보 효율은 12.8∼18.5%인 것으로 보고하였다. 그리고 ZFN를 이용하 지 않았을 경우 유전자 적중 효율은 0%로 보고하고 있다 (Liu 등, 2014). 또한 2014년에는 Moghaddassi 등(2014)이 소 serum albumin 유전자 위치에서 인간 serum albumin을 발현하는 knock-in 벡터와 TALEN을 함께 소 섬유아세포 에 삽입하여 수컷 세포에서는 9%, 암컷 세포에서는 13% 의 knock-in 효율을 확인하였다고 보고하였다. 그리고 염 소 체세포에 knock-in 벡터를 TALEN과 함께 도입하여 β-lactoglobulin 유전자 위치에서 인간 lactoferrin이 발현할 수 있는 형질전환 염소를 생산하였으며, 체세포에 있어서 상동재조합 효율은 13.6%인 것으로 보고하였다(Cui 등, 2015). 이러한 결과는 본 연구에서 얻은 적중 효율이 2.2 ~4.6%로 낮은 결과를 보이고 있지만 유전자 가위인 TALEN을 이용하여 β-casein 위치에 knock-in 벡터를 상 동재조합에 의하여 도입할 수 있음을 나타내고 있다. 또 한 본 연구에서도 TALEN을 이용하지 않았을 경우에는 knock-in 효율이 0%(결과제시 안함)로써 Liu 등(2014)의 결과와 일치하는 결과를 보였다. 그렇지만 3’ arm이 짧은 (0.64 kb) knock-in 벡터인 경우 3’ arm이 긴 knock-in 벡 터보다 낮은 상동재조합 효율을 보였다. 이러한 결과는 knock-in 벡터 구축에 이용되는 5’ arm과 3’ arm의 길이 에 따라 knock-in 효율에 영향을 줄 수 있다는 것을 나타 내는 것이라고 추측된다.

    Figure

    RDB-41-7_F1.gif
    Construction of knock-in vectors for expression of human endostatin in the bovine β-casein Exon 7 locus.

    (A) The knock-in vector was consisted with 4.8 kb fragment as the 5’ recombination arm and 1.8 kb fragment as the 3’ recombination arm. (B) The knock-in vector was consisted with 1.06 kb fragment as the 5’ recombination arm and 0.64 kb fragment as the 3’ recombination arm. (C) The knock-in vectors were consisted with 1.06 kb fragment as the 5’ recombination arm and 1.8 kb fragment as the 3’ recombination arm. The PGK-neo gene and DT-A gene without the polyA signal sequence were used as positive and negative selection markers, respectively.

    RDB-41-7_F2.gif
    Nucleotide and deduced amino acid sequence of β-casein gene fused human endostatin.

    Box were displayed TALEN binding site and underlined italics amino acid (RKRR) were displayed furin cleavage site. Underlined nucleotide were exon 7 of β-casein gene and Underlined amino acids were human endostatin gene. Boxed amino acids were indicated F2A sequence. The arrow indicates a selfcleavage site in the 2A peptide during translation.

    RDB-41-7_F3.gif
    Design and validation for TALEN on bovine β-casein exon 7.

    (A) The TALENs binding site. (B) The T7 endonucelase I assay in the MAC-T cells transfected with TALENs. M, size marker (100 bp ladder); NC, negative control; TA, Mac-T cell transfected with TALEN.

    RDB-41-7_F4.gif
    PCR analysis of knock-in somatic cell transfected with knock-in vector.

    (A) DT-A_cEndo Knock-in vector. (B) DT-A_tEndo Knock-in vector I. (C) DT-A_tEndo Knock-in vector II. The top panel shows the 3’ arm PCR. The middle panel shows the 5’ arm PCR. The lower panel shows targeted and non-targeted alleles. M, size marker(1 kb ladder); NC, negative control; PC, positive control; Number, G418-resistant colonies; WT, wild type.

    Table

    Efficiency of gene targeting on the β-casein locus of the fibroblasts transfected with knock-in vector

    Reference

    1. Clark AJ , Burl S , Denning C , Dickinson P (2000) Gene targeting in livestock a preview , Transgenic Res, Vol.9 ; pp.263-275
    2. Cui C , Song Y , Liu J , Ge H , Li Q , Huang H , Hu L , Zhu H , Jin Y , Zhang Y (2015) Gene targeting by TALEN-induced homologous recombination in goats directs production of ?-lactoglobulin-free, high-human lactoferrin milk , Sci Rep, Vol.5 ; pp.1-11
    3. Denning C , Burl S , Ainslie A , Bracken J , Dinnyes A , Fletcher J , King T , Ritchie M , Ritchie WA , Rollo M , de Sousa P , Travers A , Wilmut I , Clark AJ (2001) Deletion of the alpha(1,3)galactosyl transferase (GGTA1):gene and the prion protein (PrP) gene in sheep , Nat Biotechnol, Vol.19 ; pp.559-562
    4. Denning C , Priddle H (2003) New frontiers in gene targeting and cloning success, application and challenges in domestic animals and human embryonic stem cells , Reproduction, Vol.126 ; pp.1-11
    5. Gaj T , Gersbach CA , Barbas CF 3rd (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering , Trends Biotechnol, Vol.31 ; pp.397-405
    6. Jeong YH , Kim YJ , Kim EY , Kim SE , Kim J , Park MJ , Lee HG , Park SP , Kang MJ (2015) Knock-in fibroblasts and transgenic blastocysts for expression of human FGF2 in the bovine ?-casein gene locus using CRISPR/Cas9 nuclease-mediated homologous recombination , Zygote, Vol.24 ; pp.442-456
    7. Joung JK , Sander JD (2013) TALENs: a widely applicable technology for targeted genome editing , Nat Rev Mol Cell Biol, Vol.14 ; pp.49-55
    8. Klymiuk N , Aigner B , Brem G , Wolf E (2010) Genetic modification of pigs as organ donors for xenotransplantation , Mol Reprod Dev, Vol.77 ; pp.209-221
    9. Lai L , Kolber-Simonds D , Park KW , Cheong HT , Greenstein JL , Im GS , Samuel M , Bonk A , Rieke A , Day BN , Murphy CN , Carter DB , Hawley RJ , Prather RS (2002) Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning , Science, Vol.295 ; pp.1089-1092
    10. Liu X , Wang Y , Guo W , Chang B , Liu J , Guo Z , Quan F , Zhang Y (2013) Zinc-finger nickase-mediated insertion of the lysostaphin gene into the β -casein locus in cloned cows , Nat Commun, Vol.4 ; pp.1-11
    11. Liu X , Wang Y , Tian Y , Yu Y , Gao M , Hu G , Su F , Pan S , Luo Y , Guo Z , Quan F , Zhang Y (2014) Generation of mastitis resistance in cows by targeting human lysozyme gene to β-casein locus using zinc-finger nucleases , Proc Biol Sci, Vol.281 ; pp.1-9
    12. Müller U (1999) Ten years of gene targeting: targeted mouse mutants, from vector design to phenotype analysis , Mech Dev, Vol.82 ; pp.3-21
    13. Miller JC , Tan S , Qiao G , Barlow KA , Wang J , Xia DF , Meng X , Paschon DE , Leung E , Hinkley SJ , Dulay GP , Hua KL , Ankoudinova I , Cost GJ , Urnov FD , Zhang HS , Holmes MC , Zhang L , Gregory PD , Rebar EJ (2011) A TALE nuclease architecture for efficient genome editing , Nat Biotechnol, Vol.29 ; pp.143-148
    14. McCreath KJ , Howcroft J , Campbell KH , Colman A , Schnieke AE , Kind AJ (2000) Production of genetargeted sheep by nuclear transfer from cultured somatic cells , Nature, Vol.405 ; pp.1066-1069
    15. Moghaddassi S , Eyestone W , Bishop CE (2014) TALEN-mediated modification of the bovine genome for large-scale production of human serum albumin , PLoS One, Vol.9 ; pp.1-6
    16. Thomas KR , Capecchi MR (1987) Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells , Cell, Vol.51 ; pp.503-512
    17. Yáñez RJ , Porter AC (1998) Therapeutic gene targeting , Gene Ther, Vol.5 ; pp.149-159
    18. Yang X , Carter MG (2007) Transgenic animal bioreactors: a new line of defense against chemical weapons? , Proc Natl Acad Sci USA, Vol.104 ; pp.13859-13860